Skip to main content

Advertisement

Table 1 The primer sequences and amplicons size of the studied SNPs

From: Involvement of polymorphisms of the nerve growth factor and its receptor encoding genes in the etiopathogenesis of ischemic stroke

Gene Accession SNP ID Primer type Nucleotide sequence of primer (5′ → 3′) Amplicon size, bp
NGF NG_007944 rs6330 reverse for standard C allele CTGAAGTTTAGTCCAGTGGG 187
reverse for minor T allele CTGAAGTTTAGTCCAGTGGA
forward constant CTGCATTTAGTACTCCATGAA
rs4839435 forward for standard G allele TGGGTGCCAAAAAGCTTGGC 188
forward for minor A allele TGGGTGCCAAAAAGCTTGGT
reverse constant GCAGCTCCTGCAATTATCCA
NGFR AC006487 rs11466155 reverse for standard C allele AGGCTATGTAGGCCACAAGG 210
reverse for minor T allele AGGCTATGTAGGCCACAAGA
forward constant CAGAGGGCTCGGACAGCACA
rs2072446 forward for standard C allele GTCCACACCCCCAGAGGGCTC 190
forward for minor T allele GTCCACACCCCCAGAGGGCTT
reverse constant AGCAGCCAGGATGGAGCAAT
rs734194 forward for standard T allele GCTGGAGCTGGCGTCTGTCT 186
forward for minor G allele GCTGGAGCTGGCGTCTGTCG
reverse constant CTAGAGCTGGGAGAAATCCC