Skip to main content

Table 3 Sequences of the primers used for quantifying the number of copies of 5q35.2-5q35.3, along with coordinates for each amplified genomic region (HG18), its relative position with regard to the start point of the duplication, and the number of copies detected in the proband

From: Bilateral radial agenesis with absent thumbs, complex heart defect, short stature, and facial dysmorphism in a patient with pure distal microduplication of 5q35.2-5q35.3

Primer name Primer sequence Chromosomal band Coordinates of the amplicon (HG18) No of copies detected in the proband Position of the amplicon in ref. to the start of the duplication
5q35.2_A1_F AACAGGCTCACGCCTTCTTA 5q35.2 175182611 - 175182696 2 - 61 kb
5q35.2_ A1_R GAAGCACCCAACACATCCTT
5q35.2_ A2_F CCTTACCAGCAGGGACACAT 5q35.2 175201237 - 175201316 2 - 42 kb
5q35.2_ A2_R CATGGCCCTCCTACACATCT
5q35.3_B1_F GTGGAATGATCACGATGCTG 5q35.3 175286270 - 175286357 3 + 43 kb
5q35.3_ B1_R TGCACAGTCCAACAGACACA
5q35.3_ B2_F CTGCTCAGCGGGATCTATGT 5q35.3 176356609 - 176356696 3 + 1,12 Mb
5q35.3_ B2_R TCAAGTCTGCCCCAACTCTT
5q35.3_ B3_F CCAATCCTGGCATGAGACTT 5q35.3 179355063 - 179355146 3 + 4,12 Mb
5q35.3_ B3_R GCAAACTGTGTGGGAATCCT