Skip to main content

Advertisement

Table 1 Primer sequences and their location

From: The molecular basis of beta-thalassemia intermedia in southern China: genotypic heterogeneity and phenotypic diversity

Primer Sequence(5'→3') GenBank No. Location Nucleotide(nt) Product length
β-540 FP: tttcccaaaacctaataagtaac RP: aacttcatccacgttcacc NG_000007 NG_000007 nt69848-nt69870 nt70647-nt70665 818 bp
Gγ-promoter FP:tgaaactgttgctttatagga t RP: gagcttattgataacctcagacg NG_000007 NG_000007 nt42215-nt42236 nt42850-nt42872 657 bp
Aγ-promoter FP:ctgctaactgaagagactaagatt RP: caaatcctgagaagcgacct NG_000007 NG_000007 nt47259-nt47283 nt47962-nt47981 723 bp
α2-globin gene FP:tggagggtggagacgtcctg RP: ccattgttggcacattccgg NG_000006 NG_000006 nt33537-nt33556 nt34062-nt34621 1085 bp
α1-globin gene FP:tggagggtggagacgtcctg RP:tccatcccctcctcccgcccctgccttttc NG_000006 NG_000006 nt37341-37360 nt38492-38521 1180 bp
BCL11A FP: tgaggagacccaaacagttaaag RP: aacccacatggcaaccaatag NT_022184 NT_022184 nt49880-nt49902 nt50359-nt50379 500 bp
AHSP FP:tgtcatgtaatagggctcagtaa RP:tggtcactcaaggctgctaac NW_001838236.1 NW_001838236.1 nt1217371-nt1217395 nt1218685-nt1218705 1335 bp
HRI FP: accccgaatatgacgaatc RP: aaggcttactaaatacaacg NM_014413 NM_014413 nt166-nt184 nt2034-nt2053 1888 bp
GATA-1 FP: tgggatcacactgagcttgc RP: gctacaagaggagaaggacacc NM_002049 NM_002049 nt10-nt29 nt1365-nt1387 1378 bp