Skip to main content

Table 1 Primer sequences and their location

From: The molecular basis of beta-thalassemia intermedia in southern China: genotypic heterogeneity and phenotypic diversity

Primer Sequence(5'→3') GenBank No. Location Nucleotide(nt) Product length
β-540 FP: tttcccaaaacctaataagtaac
RP: aacttcatccacgttcacc
NG_000007
NG_000007
nt69848-nt69870
nt70647-nt70665
818 bp
Gγ-promoter FP:tgaaactgttgctttatagga t
RP: gagcttattgataacctcagacg
NG_000007
NG_000007
nt42215-nt42236
nt42850-nt42872
657 bp
Aγ-promoter FP:ctgctaactgaagagactaagatt
RP: caaatcctgagaagcgacct
NG_000007
NG_000007
nt47259-nt47283
nt47962-nt47981
723 bp
α2-globin gene FP:tggagggtggagacgtcctg
RP: ccattgttggcacattccgg
NG_000006
NG_000006
nt33537-nt33556
nt34062-nt34621
1085 bp
α1-globin gene FP:tggagggtggagacgtcctg
RP:tccatcccctcctcccgcccctgccttttc
NG_000006
NG_000006
nt37341-37360
nt38492-38521
1180 bp
BCL11A FP: tgaggagacccaaacagttaaag
RP: aacccacatggcaaccaatag
NT_022184
NT_022184
nt49880-nt49902
nt50359-nt50379
500 bp
AHSP FP:tgtcatgtaatagggctcagtaa
RP:tggtcactcaaggctgctaac
NW_001838236.1
NW_001838236.1
nt1217371-nt1217395
nt1218685-nt1218705
1335 bp
HRI FP: accccgaatatgacgaatc
RP: aaggcttactaaatacaacg
NM_014413
NM_014413
nt166-nt184
nt2034-nt2053
1888 bp
GATA-1 FP: tgggatcacactgagcttgc
RP: gctacaagaggagaaggacacc
NM_002049
NM_002049
nt10-nt29
nt1365-nt1387
1378 bp