Skip to main content

Advertisement

Table 1 SNPs in TGFβ1, TNFα, CCR2 and CCR5 genes, their location, primer sequences, PCR conditions and restriction enzyme with product sizes.

From: Association of TGFβ1, TNFα, CCR2 and CCR5 gene polymorphisms in type-2 diabetes and renal insufficiency among Asian Indians

Polymorphism Primer sequence Product size (bp) Annealing temp./restriction enzyme/allele sizes
TGFβ1 G>A (-800) Promoter F: 5' GGCAGTTGGCGAGAACAGT-3' R: 5' ACCCAGAACGGAAGGAGAGT3' 600 57°C/Tai I/ G = 199, 401 A = 600
TGFβ1 C>T (-509) Promoter F: 5'-GGCAGTTGGCGAGAACAGT-3' R: 5'-ACCCAGAACGGAAGGAGAGT-3' 600 57°C/Eco 8I1/ C = 489,111 T = 600
TGFβ1 Arg25Pro Exon 1 F: 5'TTC CCT CGA GGC CCT CCT A3' R: 5' CAC AGC AGC GGT AGC AGC TG3' 294 61°C/Sac II/ G = 202,67,25 C = 269,25
TGFβ1 Tyr81His Exon 2 F: 5' CCAGATCCTGTCCAAGCTG3' R: 5' TGGGTTTCCACCATTAGCAC3' 198 57°C/Rsa I/ T = 89,109 C = 198
TGFβ1 Thr263Ile Exon 5 F: 5' CACCAAAGCAGGGTTCACTA3' R: 5' ATCCAGGCTACAAGGCTCA3' 238 58°C/Fok I/ C = 238 T = 84, 154
TNFα G>A -308 Promoter F:5'AGGCAATAGGTTTTGAGGGcCAT3' R:5'GGGACACACAAGCATCAAGGATAC3' 146 37°C/Nco I/ G = 146 A = 122, 24
CCR2 Val64Ile Exon 1 F: 5'TTG TGG GCA ACA TGA TGG3' R: 5'GCA TTC CCA AAG ACC CAC TC3' 163 57°C/BsaBI/ T = 163 C = 145,18
CCR5 G>A (59029) Promoter F: 5' CAG TCA ACC TGG GCA AAG CC3' R: 5' AGC TTT GGT CCT GAG AGT CC3' 453 57°C/Bst 1286I/ G = 408, 45 A = 453
CCR5 Δ32 Promoter F:5' GAAGTTCCTCATTACACCTGCAGCTCTC3' R:5' CTTCTTCTCATTTCGACACCGAAGCAG AG3' 174/142 55°C/ 1 = 174 2 = 142