Skip to main content

Advertisement

Table 1 Primers used in the analysis of the EDAR gene. Intronic primer sequences, annealing temperatures and sizes of PCR products suitable for DHPLC analysis and DNA sequencing of the EDAR gene.

From: EDAR mutation in autosomal dominant hypohidrotic ectodermal dysplasia in two Swedish families

Exon no. Forward primer (5'-3') Reverse primer (5'-3') Optimal annealing temp.* (°C) Fragment size (bp)
2 TTTGCTGGAAGGCACCTTAT AGAGGCCAAGAAACAGTCCA 58–62 243
3 ACCCCCTTCCTATGTCAACC CAGGCTCAGGGCAACAAT 56–62 292
4 CGGCAAGAGTAGCTTCTGGA GCAGTATCCATGACCCCTGT 51–63 397
5 GTGCTCTCTGCACCAGTCC GACCGGCTCTTTCCTACACC 52–63 246
6 AGCTCTGTGGCAGCGTCT CCTCTCCTCTTCTGAGCTTTCA 51–62 228
7 + 8 GGAGTCCTGGAGGGAAGACC AGCATGTGAGAGCAGAAGCA 60 468
9 AGAGCAGGGTTGGGCTGAG GCTAGCCTGTCAGTTCACTCG 51–63 248
10 AGGTGCCCAGTAAACACCTG CGTCTTGCAGGAGAGCTGAT 51–63 400
11 CCTGCTGACATGGAGGATTT CTCAGTTCCCCTCACAGGAG 51–63 234
12 GACCTTCTATTGACTGTGACTTGC CAGTCTTTTGGCACCACTCA 51–63 461
  1. *As indicated by gradient PCR reactions.