Skip to main content

Table 1 Oligonucleotides and restriction enzymes used for SSCP analyses of the exonic and 593 bp promoter regions of the RXRB gene.

From: On the Wegener granulomatosis associated region on chromosome 6p21.3

Exon Oligonucleotide sense/antisense PCR product (bp) Restriction enzyme; length of fragments (bp)
01a CGGTATCCCTACTCTCAGCCA/GCGGGATCCAGCCAGG 164 -
01b GGTGCGAAAAGAAATGCA/CACTGGCTCGCCTGCC 202 -
02 CTCTTGTGTGTCTGTGTGCCT/GGTTAGAGGATTGGAAGGTCA 403 AvaII 176/227
03 GACTTCCCTATTTCCCCCAT/TCTCGGAGAAGAGGAGGCT 207 -
04 TGAAGGTGTCTCCATGCAAC/AGAAGGGCATGTGGTCTAAGA 275 BsmFI 126/149
05 CTGATGAGGCCGTAAGGATA/GTGGATTGACCCCAACACT 280 Eco24I 130/150
06 TCCATAACTCTTACCCCCGT/CTGGGTACGCAAGGTAAGG 255 MboII 102/153
07 CCTGATTTCTGGCTCCTGAC/CCTCTATCTACATGCCAGCCT 209 -
08 GCTGAGCTGTGACCTTTGAGT/TCTCGGAGAAGAGGAGGCT 199 -
09 CTCCTCTCTTCCCTGCCAT/CCTCATAGCACTCCCCACC 199 -
10 CTCAATCCCCTTCTCCCAC/AGTGTGAGAAGCACCACGTC 209 -
Promoter (593 bp)    
Sys1 GGGCTTAATTCGACCCAA/GCATTTCTTTTCGCACC 213 -
Sys2 GCTAACAGGCCGGAGGAGA/GGATTGATCGGAGGATTAGCT 212 -
Sys3 CTCTCCTTTCCCGGTTTG/TCGTCTAGTTGGAAACCGAG 234 -
Sys4 CTCTTTATCCCGAACCACCT/TCTCGCGGGATCTAAAGG 221 -
Sys5 CATCACGCTGACCAGAGG/TGGTGAAAGATTAGTGTCCCA 214 -