Skip to main content

Advertisement

Table 1 Primer sequences for primers used in the PCR and pyrosequencing reactions

From: DNA methylation within the I.4 promoter region correlates with CYPl19A1 gene expression in human ex vivo mature omental and subcutaneous adipocytes

  Primer name Sequence (5′ to 3′)
I.4.1, I.4.2a I.4a PCR F GGAATGGTGAGAGTTTGGTTAATG
  I.4a PCR R *CAAAAAACACCCTAAAATATAACCTACAA
  I.4a Seq.b GTAAAGTGTTTGTTTTTTTATAGT
I.4.3, I.4.4a I.4c PCR F GGAATGGTGAGAGTTTGGTTAATG
  I.4c PCR R *CAAAAAACACCCTAAAATATAACCTACAA
  I.4c Seq.b CTACAATAAAAACACATTTCTT
I.4.5 I.4b PCR F *AGGAGATTTTTGATTTATGTGGGGTTATG
  I.4b PCR R ACTCAAACTCCAAAAACTTACCTAAT
  I.4b Seq.b CCCATCACATCACTC
  1. aEncompasses two CpG sites upstream of the promoter. bSequencing primer. *Biotinylated at 5′ end and HPLC purified to enable capture of the PCR products by the PyroMark vacuum station filter probes.