Skip to main content

Table 2 Sequences of the primers used for SALL4 gene (MIM ID*607343; GenBank NM_020436) amplification and sequencing

From: Bilateral radial agenesis with absent thumbs, complex heart defect, short stature, and facial dysmorphism in a patient with pure distal microduplication of 5q35.2-5q35.3

Exon name (fragment) Forward primer sequence 5- 3 Reverse primer sequence 5- 3 Product size (bp)
SALL4_e1 GGGGTAAATTTCCCAACTCC GCGTACGTCCGGGAAGC 263
SALL4_e2(a) atagatgtgagcgacggtgc AAGGTCTTCAGAGTGTCGGC 729
SALL4_e2(b) TGGTGCCAACAGCATCC CACTTTGTCCTGGAACTCGG 730
SALL4_e2(c) CTGTCTGTGGTCATCGCTTC GCATCACGGCATTAGTGAAC 684
SALL4_e2(d) AGACACACCTTGGGGTTCAC TAAAGTTCAACCCAGGCTCC 708
SALL4_e3 AAAGATCTCTTTTGCTTTGAAGAG TGCCAATAAGAAGACACCTGG 420
SALL4_e4 ATTCTTGGCTTGCCAGTGAG TCGTGATTGTAGCACTTGCC 652