Skip to main content

Table 1 Sequences of the primers used for TBX5 gene (MIM ID*601620; GenBank NM_000192) amplification and sequencing

From: Bilateral radial agenesis with absent thumbs, complex heart defect, short stature, and facial dysmorphism in a patient with pure distal microduplication of 5q35.2-5q35.3

Exon name (fragment) Forward primer sequence 5- 3 Reverse primer sequence 5- 3 Product size (bp)
TBX5_e2 TCTCTCTCTGTCCTCCCCAC CAAGAGAAGCCGAGCAGG 310
TBX5_e3 GGGAAGGAATGCCCACTAC TTCCaagccaccttttcttc 231
TBX5_e4 TTAAAATGGATGGAGGCTGC TTTTGGGAGAAGGTTCCAC 256
TBX5_e5 GTGCAGTGCGCTACCTCC GAAACCCagtgagaagaaggg 279
TBX5_e6 GGTTTTATCTGGAGACAAAGGG CAGGAAAACCTTGCAGATTC 293
TBX5_e7 CATGTCCTGAGGTGGTCTTG GTTGCTGCTGGCTTACCTG 232
TBX5_e8 TCAGCCACTCAGGAAATCTG CCCCAACCCAAGGAAAGG 356
TBX5_e9 CTCCACTTTTAGCTGCCTGG TAGATCAGCATCCAGCGACC 797