Skip to main content

Advertisement

Table 1 PALB2 gene primers sequences

From: A novel germline PALB2 deletion in Polish breast and ovarian cancer patients

Exon Forward primer Reverse primer
1 GATTTAATTGGCCGGAGTTT GGGTGGTCAGATGATACTGC
2 - 3 CTTGCCCAGTATTGTTTGGTG GCAGGCATAAGTGAATGGTC
4a TCATCTGCCTGAATGAAATG TGAGTGAATCAGTGCCAAAG
4b CAAGAACATTTTCCCCACAG GGAGGAATGTGTTCAAGGTG
4c AGGGCGACTACAGTTCCTTT TGCAGAAAGAGGAGAGGTTG
4d TTGATGGCAGGAATGAAAAT GCAACTGCCTTCCTAGACAA
4e ATGCACAGGACAACCAAGTT TTGGCCCTGTCACTTTTTAG
5a TGTCTGTTTTGTTGGGTTTTG TCCATGCGTTTAGGACTCAG
5b TGCTCAGAAAAACCAGTGGA AGCAAGTTCGTCCAGCAAC
5c CCCTCAAGGCTCCTATGAAA GGCATTTCATTCCTTCAGAGA
6 GTGGGTAATGCAGGCAGAC TGTTTTTCTGAATCTGTTTACCAA
7 TTTGCATAAAACAGCACTCG TTTGGTAAGCTGCCCATCTA
8 TGATAAATTTTGGAAAATCTGGA CTGCACTTAAAACCAGCTGAC
9 ACTCCTCACATCACCCCATT TATTACACCCCCAGCACAGA
10 CGGAGAAGGGCTACCTAGAG GCAACACAAAACCACAATCA
11 TTGTTTGTTGGAAGAATGTGA CGGGGAAGGTTTGTTCATTA
12 AGAGCCTATCGGTCATTGCT TTCAGAATGTCCCACCCATA
13 GGATTTTTGTTCCTGTTGCTG TCTCCTTTATATTTAAAACTCCAAAAA