From: Association study of SHANK3 gene polymorphisms with autism in Chinese Han population
SNP | Primer sequence (5'→3') | Product (bp) | RFLP | Allele (bp) |  |
---|---|---|---|---|---|
rs9616915 | Forward: acctgggggcttcacctgacta Reverse: cccaacccagcacacagagg | 207 | Ava II | T (180/27) | C (121/59/27) |
rs13057681 | Forward: ccgcaagagccccctggtga Reverse: caggaggcgctcgtcgatggag | 328 | Sty I | G (198/130) | C (328) |
rs6010065 | Forward: ccttacctgggtgggcatt Reverse: acggggagggctcttgtg | 423 | Hinf I | G (166/257) | C (423) |
rs2106112 | Forward: ctgagccactcggaggttgct Reverse: gtccgaccttcaccacgttcac | 340 | Â | Â | Â |
rs2301584, rs41281537, rs756638 | Forward: cgccaacagtccaggtcac Reverse: cagaaggcatgggctgagtt | 489 | Â | Â | Â |
G insertion in exon21 | Forward: cgggaggagcggaagtcac Reverse: ggaccccgttggcaaactct | 409 | Â | Â | Â |
A962G in exon8 | Forward: cgcacgccatgtgtgcattcct Reverse: tctcggggttggggggtcagac | 473 | Â | Â | Â |
splice doner site of intron19 | Forward: gcctggggtggggtctgag Reverse: ttggagcctgggctgtgtg | 754 | Â | Â | Â |