Skip to main content

Advertisement

Table 1 PCR-RFLP conditions for VDR gene polymorphisms (GenBank AY342401)

From: Association of vitamin D receptor polymorphisms with the risk of prostate cancer in the Han population of Southern China

SNP Primer Base change Annealing temperature Restriction enzyme
FokI 5'AGCTGGCCCTGGCACTGACTCTGCTCT3'(F) C/T 61°C Fok I
  5'ATGGAAACACCTTGCTTCTTCTCCCTC 3'(R)    
BsmI 5'CAACCAAGACTACAAGTACCGCGTCAGTGA3'(F) G/A 57°C Mva1269 I
  5'AACCAGCGGGAAGAGGTCAAGGG3'(R)    
Tru9I 5'CAACCAAGACTACAAGTACCGCGTCAGTGA3'(F) G/A 57°C Tru1 I
  5'AACCAGCGGGAAGAGGTC AAGGG3'(R)    
ApaI 5'CAGAGCATGGACAGGGAGCAA3'(F) G/T 60°C Apa I
  5'GCAACTCCTCATGGCTGAGGTCTC3'(R)    
TaqI 5'CAGAGCATGGACAGGGAGCAA3'(F) T/C 60°C Taq I
  5'GCAACTCCTCATGGCTGAGGTCTC3'(R)